Showing posts with label sequencing. Show all posts
Showing posts with label sequencing. Show all posts

06 October 2008

Googling the Genome

We're getting close:

The cost of determining a person’s complete genetic blueprint is about to plummet again — to $5,000.

That is the price that a start-up company called Complete Genomics says it will start charging next year for determining the sequence of the genetic code that makes up the DNA in one set of human chromosomes. The company is set to announce its plans on Monday.

Such a price would represent another step toward the long-sought goal of the “$1,000 genome.” At that price point it might become commonplace for people to obtain their entire DNA sequences, giving them information on what diseases they might be predisposed to or what drugs would work best for them.

15 August 2007

Welcome to the Era of Personal Genomics

I've been wittering on about personal genomics for some time: well, it's here, people. If you don't believe, me, take a look at this site (note, it's one of those old-fashioned FTP thingies, but Firefox should cope just fine).

Not much to see, you say? Just a couple of boring old directories - one called "Venter", the other "Watson". And inside those directories, lots of pretty massive files - some 35 Mbytes, some double that. And inside those files? Oh, just some boring letters; you know the kind of thing - AAGTGGTACCATTGACGCACAGGACACAGTG etc.

Nothing much: just the essence of the first two people to have their entire genomes (or nearly) sequenced - and all made freely available.... (Via Discovering Biology in a Digital World.)

12 May 2006

The Barcode of Life

Since DNA is digital information, it is, essentially, a number. A very, very, very big number. And because nearly every cell in a living thing contains the same genome, unique to the individual (leaving aside twins etc.), in principle this means that every being is barcoded in every cell.

Of course, in practice, this isn't much help, since sequencing is still pretty costly. But we don't need all those several million/billion DNA letters to barcode life: a few hundred will do, if chosen judiciously.

That's precisely what the group with the wonderfully literal name of "The Consortium for the Barcode of Life" has come up with. This Wired report brings us up to date on the bird part of the project (there's a fishy one too) that will eventually turn every species - if not every individual - into a number. That's a later project that governments around the world will carry out as a follow-up (did anyone say ID card?).