Personal Genomics...but Not Yet

A new X-prize, this time for exploring inner rather than outer space, has been announced. To win the prize money, all you have to do is sequence the DNA of a 100 or more people in a few weeks. That may sound a little vague, but it is many orders of magnitude faster than we can do it now (and remember, the first human genome took about 15 years and three billion dollars).

Why bother? Well, it will open up the world of personal genomics: where the particular details of your genome - not the human genome in general - will be used to aid diagnosis and help doctors make decisions about treatment.

The X-prize announcement is really tantamount to recognising that all those breathless predictions of imminent personal genomes, made by some at the time of the Human Genome Project, were rather optimistic.

I have to say that I, for one, am not too sad. Much as I'd like to Google my genome, being able to do so will also raise considerable ethical dilemmas, as I discussed in my book Digital Code of Life.

As St. Augustine nearly said: "Give me genotypability - but not yet...."

Welcome to the Era of Personal Genomics

I've been wittering on about personal genomics for some time: well, it's here, people. If you don't believe, me, take a look at this site (note, it's one of those old-fashioned FTP thingies, but Firefox should cope just fine).

Not much to see, you say? Just a couple of boring old directories - one called "Venter", the other "Watson". And inside those directories, lots of pretty massive files - some 35 Mbytes, some double that. And inside those files? Oh, just some boring letters; you know the kind of thing - AAGTGGTACCATTGACGCACAGGACACAGTG etc.

Nothing much: just the essence of the first two people to have their entire genomes (or nearly) sequenced - and all made freely available.... (Via Discovering Biology in a Digital World.)

Googling the Genome, Part III

Good to see some others concerned by the imminent arrival of personal genomics:

In addition, many scientists fear cheap genome sequencing could have other, worrying consequences. Professor Steve Jones of University College London, said: 'If you make your genome public, you are not just revealing information about yourself and what diseases you might be susceptible to, you are also giving away crucial data about the kind of illnesses your children might be prone to. Each of your children gets half your genes, after all. They might not want the world to know about the risks they face and become very unhappy in later life that you went public. Your other relatives might equally be displeased.'

And by its implications for civil liberties:

However, there are other concerns, as Professor Ashburner points out. 'Anyone who commits relatively minor offences can have their DNA taken and analysed. At present, the main use of this process is to create a DNA fingerprint that can be used to identify that individual. But soon we will be able to create an entire genome sequence of that individual from a swab or blood sample. We will end up knowing everything about their genes. In the end, we could have millions of people on a database and know every single genetic secret of each person. That has to be a very worrying prospect.'

DNA Vu

Now, where have I heard this before?

Today it costs only $300,000 to sequence a person's DNA, and the $100,000 benchmark is in sight. It's an information processing problem, he said. In other words, Moore's Law and genetics are tightly tied. It won't be long before your genome--and your likelihood to get various diseases, live long, be athletic, etc.--will be available in a standard medical test.

The implications for medicine, and its evil twin the insurance industry, are vast. Despite the privacy issues, Venter is in favor of transparency in genomics, so that, for example, you'll be able to "Google a date's DNA," as O'Reilly remarked. Scary? Sure. But "a good idea," Venter said. "Especially if you plan to have children."

Oh yes, I remember:

Consider a not-too-distant future in which personal genomes are readily available. For those with relations affected by a serious medical condition, this will conveniently provide them with any genetic test they need. But it will also offer the rest of us information about our status for these and other, far less serious, autosomal recessive disorders that might similarly manifest themselves in children if we married a fellow carrier.

A bioinformatics program running on a PC could easily check our genomes for all genes associated with the autosomal recessive disorders that had been identified so far. Regular software updates downloaded from the internet - like those for anti-virus programs - would keep our search software abreast of the latest medical research. The question is, how potentially serious does a variant gene's effects have to be for us to care about its presence in our DNA? Down to what level should we be morally obliged to tell our prospective partners - or have the right to ask about?

And just when is the appropriate moment to swap all these delicate DNA details? Before getting married? Before going to bed together? Before even exchanging words? Will there one day be a new class of small, wireless devices that hold our personal genomic profile in order to carry out discreet mutual compatibility checks on nearby potential partners: a green light for genomic joy, a red one for excessive recessive risks?

Given the daunting complexity of the ethical issues raised by knowing the digital code of life in detail, many may opt for the simplest option: not to google it. But even if you refuse to delve within your genome, there are plenty of others who will be keen to do so. Employers and insurance companies would doubtless love to scan your data before giving you a job or issuing a policy. And if your children and grandchildren have any inconvenient or expensive medical condition that they have inherited from one side of the family, they might like to know which - not least, to ensure that they sue the right person.

Open Knowledge, Open Greenery and Modularity

On Saturday I attended the Open Knowledge 1.0 meeting, which was highly enjoyable from many points of view. The location was atmospheric: next to Hawksmoor's amazing St Anne's church, which somehow manages the trick of looking bigger than its physical size, inside the old Limehouse Town Hall.

The latter had a wonderfully run-down, almost Dickensian feel to it; it seemed rather appropriate as a gathering place for a ragtag bunch of ne'er-do-wells: geeks, wonks, journos, activists and academics, all with dangerously powerful ideas on their minds, and all more dangerously powerful for coming together in this way.

The organiser, Rufus Pollock, rightly placed open source squarely at the heart of all this, and pretty much rehearsed all the standard stuff this blog has been wittering on about for ages: the importance of Darwinian processes acting on modular elements (although he called the latter atomisation, which seems less precise, since atoms, by definition, cannot be broken up, but modules can, and often need to be for the sake of increased efficiency.)

One of the highlights of the day for me was a talk by Tim Hubbard, leader of the Human Genome Analysis Group at the Sanger Institute. I'd read a lot of his papers when writing Digital Code of Life, and it was good to hear him run through pretty much the same parallels between open genomics and the other opens that I've made and make. But he added a nice twist towards the end of his presentation, where he suggested that things like the doomed NHS IT programme might be saved by the use of Darwinian competition between rival approaches, each created by local NHS groups.

The importance of the ability to plug into Darwinian dynamics also struck me when I read this piece by Jamais Cascio about carbon labelling:

In order for any carbon labeling endeavor to work -- in order for it to usefully make the invisible visible -- it needs to offer a way for people to understand the impact of their choices. This could be as simple as a "recommended daily allowance" of food-related carbon, a target amount that a good green consumer should try to treat as a ceiling. This daily allowance doesn't need to be a mandatory quota, just a point of comparison, making individual food choices more meaningful.

...

This is a pattern we're likely to see again and again as we move into the new world of carbon footprint awareness. We'll need to know the granular results of actions, in as immediate a form as possible, as well as our own broader, longer-term targets and averages.

Another way of putting this is that for these kind of ecological projects to work, there needs to be a feedback mechanism so that people can see the results of their actions, and then change their behaviour as a result. This is exactly like open source: the reason the open methodology works so well is that a Darwinian winnowing can be applied to select the best code/content/ideas/whatever. But that is only possible when there are appropriate metrics that allow you to judge which actions are better, a reference point of the kind Cascio is writing about.

By analogy, we might call this particular kind of environmental action open greenery. It's interesting to see that here, too, the basic requirement of modularity turns out to be crucially important. In this case, the modularity is at the level of the individual's actions. This means that we can learn from other people's individual success, and improve the overall efficacy of the actions we undertake.

Without that modularity - call its closed-source greenery - everything is imposed from above, without explanation or the possibility of local, personal, incremental improvement. That may have worked in the 20th century, but given the lessons we have learned from open source, it's clearly not the best way.

Pat "Nutter" Brown Strikes Again

To change the world, it is not enough to have revolutionary ideas: you also have the inner force to be able to realise them in the face of near-universal opposition/indifference/derision. Great examples of this include Richard Stallman, who ploughed his lonely GNU furrow for years before anyone took much notice, and Michael Hart, who did the same for Project Gutenberg.

Another of these rare beings with both vision and tenacity is Pat Brown, a personal hero of mine. Not content with inventing one of the most important experimental tools in genomics - DNA microarrays - Brown decided he wanted to do something ambitious: open access publishing. This urge turned into the Public Library of Science (PLoS) - and even that is just the start:

PLoS is just part of a longer range plan. The idea is to completely change the way the whole system works for scientific communication.

At the start, I knew nothing about the scientific publishing business. I just decided this would be a fun and important thing to do. Mike Eisen, who was a post-doc in my lab, and I have been brain-storming a strategic plan, and PLoS was a large part of it. When I started working on this, almost everyone said, “You are completely out of your mind. You are obviously a complete idiot about how publishing works, and besides, this is a dilettante thing that you're doing.” Which I didn't feel at all.

I know I'm serious about it and I know it's doable and I know it's going to be easy. I could see the thermodynamics were in my favor, because the system is not in its lowest energy state. It's going to be much more economically efficient and serve the customers a lot better being open access. You just need a catalyst to GET it there. And part of the strategy to get it over the energy barrier is to apply heat—literally, I piss people off all the time.

In case you hadn't noticed, that little plan "to completely change the way the whole system works for scientific communication" is coming along quite nicely. So, perhaps buoyed up by this, Brown has decided to try something even more challenging:

Brown: ... I'm going to do my sabbatical on this: I am going to devote myself, for a year, to trying to the maximum extent possible to eliminate animal farming on the planet Earth.

Gitschier: [Pause. Sensation of jaw dropping.]

Brown: And you are thinking I'm out of my mind.

Gitschier: [Continued silence.]

Brown: I feel like I can go a long way toward doing it, and I love the project because it is purely strategy. And it involves learning about economics, agriculture, world trade, behavioral psychology, and even an interesting component of it is creative food science.

Animal farming is by far the most environmentally destructive identified practice on the planet. Do you believe that? More greenhouse production than all transportation combined. It is also the major single source of water pollution on the planet. It is incredibly destructive. The major reason reefs are dying off and dead zones exist in the ocean—from nutrient run-off. Overwhelmingly it is the largest driving force of deforestation. And the leading cause of biodiversity loss.

And if you think I'm bullshitting, the Food and Agricultural Organization of the UN, whose job is to promote agricultural development, published a study, not knowing what they were getting into, looking at the environmental impact of animal farming, and it is a beautiful study! And the bottom line is that it is the most destructive and fastest growing environmental problem.

Gitschier: So what is your plan?

Brown: The gist of my strategy is to rigorously calculate the costs of repairing and mitigating all the environmental damage and make the case that if we don't pay as we go for this, we are just dumping this huge burden on our children. Paying these costs will drive up the price of a Big Mac and consumption will go down a lot. The other thing is to come up with yummy, nutritious, affordable mass-marketable alternatives, so that people who are totally addicted to animal foods will find alternatives that are inherently attractive to eat, so much so that McDonald's will market them, too. I want to recruit the world's most creative chefs—here's a REAL creative challenge!

I've talked with a lot of smart people who are very keen on it actually. They say, “You have no chance of success, but I really hope you're successful.” That's just the kind of project I love.

Pat, the world desperately needs nutters like you. Let's just hope that the thermodynamics are in your favour once more.

Follow me @glynmoody on Twitter or identi.ca.

Maybe Genomics is Getting a Little Too Personal

So Jim Watson's genome will soon be made public. But not all of it:

the only deliberate omission from Watson's sequence is that of a gene linked to Alzheimer's disease, which Watson, who is now 79, asked not to know about because it is incurable and claimed one of his grandmothers.

The trouble is, the better our bioinformatics gets, the more genes we will be able to analyse usefully, and the better our ability to make statistical predictions from them. Which means that more and more people will be snipping bits out of their public genomes in this way. And which also means that many of us will never put any of our genome online.