Copyright Bullying is in the DNA

Craig Venter is a bit tiresome at times, but indubitably clever. And to prove his cleverness (again) when he was creating artificial life, he thought he'd throw into the DNA a quotation or two:

In order to distinguish their synthetic DNA from that naturally present in the bacterium, Venter’s team coded several famous quotes into their DNA, including one from James Joyce’s A Portrait of the Artist of a Young Man: “To live, to err, to fall, to triumph, to recreate life out of life.”

Rather witty, no? Sadly, the humourless Joyce Estate didn't see it that way:

After announcing their work, Venter explained, his team received a cease and desist letter from Joyce’s estate, saying that he’d used the Irish writer’s work without permission. ”We thought it fell under fair use,” said Venter.

Yeah, we really need Draconian copyright laws to protect (dead) artists from this kind of evil infringement.

Follow me @glynmoody on Twitter or identi.ca.

Genomics Goes Read-Write

One of Larry Lessig's favourite tropes is that we live in a read-write world these days, where creation is just as important as consumption. Well, hitherto, genomics has been pretty much read only: you could sequence the DNA of an organism, but creating entire genomes of complex organisms (such as bacteria) has been too tricky. Now that nice Dr Venter says he's gone and done it:

A team of 17 researchers at the J. Craig Venter Institute (JCVI) has created the largest man-made DNA structure by synthesizing and assembling the 582,970 base pair genome of a bacterium, Mycoplasma genitalium JCVI-1.0. This work, published online today in the journal Science by Dan Gibson, Ph.D., et al, is the second of three key steps toward the team’s goal of creating a fully synthetic organism. In the next step, which is ongoing at the JCVI, the team will attempt to create a living bacterial cell based entirely on the synthetically made genome.

The team achieved this technical feat by chemically making DNA fragments in the lab and developing new methods for the assembly and reproduction of the DNA segments. After several years of work perfecting chemical assembly, the team found they could use homologous recombination (a process that cells use to repair damage to their chromosomes) in the yeast Saccharomyces cerevisiae to rapidly build the entire bacterial chromosome from large subassemblies.

He even gives some details (don't try this at home):

The process to synthesize and assemble the synthetic version of the M. genitalium chromosome began first by resequencing the native M. genitalium genome to ensure that the team was starting with an error free sequence. After obtaining this correct version of the native genome, the team specially designed fragments of chemically synthesized DNA to build 101 “cassettes” of 5,000 to 7,000 base pairs of genetic code. As a measure to differentiate the synthetic genome versus the native genome, the team created “watermarks” in the synthetic genome. These are short inserted or substituted sequences that encode information not typically found in nature. Other changes the team made to the synthetic genome included disrupting a gene to block infectivity. To obtain the cassettes the JCVI team worked primarily with the DNA synthesis company Blue Heron Technology, as well as DNA 2.0 and GENEART.

From here, the team devised a five stage assembly process where the cassettes were joined together in subassemblies to make larger and larger pieces that would eventually be combined to build the whole synthetic M. genitalium genome. In the first step, sets of four cassettes were joined to create 25 subassemblies, each about 24,000 base pairs (24kb). These 24kb fragments were cloned into the bacterium Escherichia coli to produce sufficient DNA for the next steps, and for DNA sequence validation.

The next step involved combining three 24kb fragments together to create 8 assembled blocks, each about 72,000 base pairs. These 1/8th fragments of the whole genome were again cloned into E. coli for DNA production and DNA sequencing. Step three involved combining two 1/8th fragments together to produce large fragments approximately 144,000 base pairs or 1/4th of the whole genome.

At this stage the team could not obtain half genome clones in E. coli, so the team experimented with yeast and found that it tolerated the large foreign DNA molecules well, and that they were able to assemble the fragments together by homologous recombination. This process was used to assemble the last cassettes, from 1/4 genome fragments to the final genome of more than 580,000 base pairs. The final chromosome was again sequenced in order to validate the complete accurate chemical structure.

But the real kicker was this comment:

“This is an exciting advance for our team and the field. However, we continue to work toward the ultimate goal of inserting the synthetic chromosome into a cell and booting it up to create the first synthetic organism,” said Dan Gibson, lead author.

Yup, you read that correctly: we're talking about porting and then *booting-up* an artificial genome, aka digital code of life.

DNA Vu

Now, where have I heard this before?

Today it costs only $300,000 to sequence a person's DNA, and the $100,000 benchmark is in sight. It's an information processing problem, he said. In other words, Moore's Law and genetics are tightly tied. It won't be long before your genome--and your likelihood to get various diseases, live long, be athletic, etc.--will be available in a standard medical test.

The implications for medicine, and its evil twin the insurance industry, are vast. Despite the privacy issues, Venter is in favor of transparency in genomics, so that, for example, you'll be able to "Google a date's DNA," as O'Reilly remarked. Scary? Sure. But "a good idea," Venter said. "Especially if you plan to have children."

Oh yes, I remember:

Consider a not-too-distant future in which personal genomes are readily available. For those with relations affected by a serious medical condition, this will conveniently provide them with any genetic test they need. But it will also offer the rest of us information about our status for these and other, far less serious, autosomal recessive disorders that might similarly manifest themselves in children if we married a fellow carrier.

A bioinformatics program running on a PC could easily check our genomes for all genes associated with the autosomal recessive disorders that had been identified so far. Regular software updates downloaded from the internet - like those for anti-virus programs - would keep our search software abreast of the latest medical research. The question is, how potentially serious does a variant gene's effects have to be for us to care about its presence in our DNA? Down to what level should we be morally obliged to tell our prospective partners - or have the right to ask about?

And just when is the appropriate moment to swap all these delicate DNA details? Before getting married? Before going to bed together? Before even exchanging words? Will there one day be a new class of small, wireless devices that hold our personal genomic profile in order to carry out discreet mutual compatibility checks on nearby potential partners: a green light for genomic joy, a red one for excessive recessive risks?

Given the daunting complexity of the ethical issues raised by knowing the digital code of life in detail, many may opt for the simplest option: not to google it. But even if you refuse to delve within your genome, there are plenty of others who will be keen to do so. Employers and insurance companies would doubtless love to scan your data before giving you a job or issuing a policy. And if your children and grandchildren have any inconvenient or expensive medical condition that they have inherited from one side of the family, they might like to know which - not least, to ensure that they sue the right person.

The Genome Goes Read-Write

Good Craig:

Craig Venter, the controversial DNA researcher involved in the race to decipher the human genetic code, has built a synthetic chromosome out of laboratory chemicals and is poised to announce the creation of the first new artificial life form on Earth.

...

Mr Venter said he had carried out an ethical review before completing the experiment. "We feel that this is good science," he said.

Bad Craig:

He has further heightened the controversy surrounding his potential breakthrough by applying for a patent for the synthetic bacterium.

The old dichotomy....

Welcome to the Era of Personal Genomics

I've been wittering on about personal genomics for some time: well, it's here, people. If you don't believe, me, take a look at this site (note, it's one of those old-fashioned FTP thingies, but Firefox should cope just fine).

Not much to see, you say? Just a couple of boring old directories - one called "Venter", the other "Watson". And inside those directories, lots of pretty massive files - some 35 Mbytes, some double that. And inside those files? Oh, just some boring letters; you know the kind of thing - AAGTGGTACCATTGACGCACAGGACACAGTG etc.

Nothing much: just the essence of the first two people to have their entire genomes (or nearly) sequenced - and all made freely available.... (Via Discovering Biology in a Digital World.)

Porting the Genomic OS

The genome can be thought of as an operating system; it runs on the cell's hardware platform (which is generally created by the operating system in perhaps the most impressive kind of biological bootstrapping). An interesting question is whether you can port the genomic OS from one kind of hardware to another. The answer is "yes":

Researchers at the J. Craig Venter Institute (JCVI) today announced the results of work on genome transplantation methods allowing them to transform one type of bacteria into another type dictated by the transplanted chromosome. The work, published online in the journal Science, by JCVI’s Carole Lartigue, Ph.D. and colleagues, outlines the methods and techniques used to change one bacterial species, Mycoplasma capricolum into another, Mycoplasma mycoides Large Colony (LC), by replacing one organism’s genome with the other one’s genome.

The next stage is to hack the genomic OS:

The ability to transfer the naked DNA isolated from one species into a second microbial species paves the way for next experiments to transplant a fully synthetic bacterial chromosome into a living organism and if successful, “boot up” the new entity. There are many important applications of synthetic genomics research including development of new energy sources and as means to produce pharmaceuticals, chemicals or textiles.

It also allows all kinds of synthesised nasties, as the team behind the work recognise:

Dr. Venter and the team at JCVI continue to be concerned with the societal implications of their work and the field of synthetic genomics generally. As such, the Institute’s policy team, along with the Center for Strategic & International Studies (CSIS), and the Massachusetts Institute of Technology (MIT), were funded by a grant from the Alfred P. Sloan Foundation for a 15-month study to explore the risks and benefits of this emerging technology, as well as possible safeguards to prevent abuse, including bioterrorism. After several workshops and public sessions the group is set to publish a report in summer 2007 outlining options for the field and its researchers.

Heavy stuff.

The Bad Boy of Genomics Strikes Again

When I was writing Digital Code of Life, I sought to be scrupulously fair to Craig Venter, who was often demonised for his commercial approach to science. Ind fact, it seemed to me he had often gone out of his way to make the results of his work available.

So it's with some sadness that I note that the "Bad Boy of Genomics" epithet seems justified in this more recent case:

A research institute has applied for a pat­ent on what could be the first largely ar­ti­fi­cial or­gan­ism. And peo­ple should be al­armed, claims an ad­vo­ca­cy group that is try­ing to shoot down the bid.

...

The ar­ti­fi­cial or­gan­ism, a mere mi­crobe, is the brain­child of re­search­ers at the Rock­ville, Md.-based J. Craig Ven­ter In­sti­tute. The or­gan­iz­a­tion is named for its found­er and CEO, the ge­net­icist who led the pri­vate sec­tor race to map the hu­man ge­nome in the late 1990s.

The re­search­ers filed their pat­ent claim on the ar­ti­fi­cial or­gan­ism and on its ge­nome. Ge­net­i­cally mo­di­fied life forms have been pa­tented be­fore; but this is the first pa­tent claim for a crea­ture whose genome might be created chem­i­cally from scratch, Mooney said.

This is problematic on a number of levels. For a start, it shouldn't be possible to patent DNA, since it is not an invention. Simply combining existing sequences is not an invention either. There is also the worry that what is being created here is the first genomic operating system: locking others out with patents maans repeating all the mistakes that have been made in some jurisdictions by allowing the patenting of conventional software.

The World's First Open Source Man

The genome – the totality of DNA found in practically every cell in our body - is a kind of computer program, stored on 23 pairs of biological DVDs, called chromosomes. Within each chromosome, there are thousands of special sub-routines known as genes. Between the genes lie stretches of the main program that calls the subroutines, as well as spacing elements to make the code more legible, and non-functional comments – doubtless deeply cool when they were first written – that have by now lost all their meaning for us.

DNA's digital code – written not in binary, but quaternary (usually represented by the initials of the four chemicals that store it: A, C, G and T) – is run in a wide range of cellular computers, using a central processing unit (known as a ribosome), and with various initial values and time-dependent inputs supplied in a special format, as proteins. The cell computer produces similarly-formatted outputs, which may act on both itself and other cells.

Thanks to a far-sighted agreement known as the Bermuda Principles, the digital code that lies at the heart of life is freely available from three main databases: one each in the US, UK and Japan. As a result, the DNA that was obtained through the Human Genome Project is open source's greatest triumph.

But so far, no human genome can be said to represent any single human being: that of the Human Genome Project is in fact a composite, made up of a couple of dozen anonymous donors. But soon, all that will change; for the first time, the complete genome of a single person will be placed in the public databases for anyone to download and to use, creating in effect the world's first open source man.

His name is Craig Venter, and for nearly two decades he has been simultaneously revered and reviled as one of the most innovative researchers in the world of genomics. He was the person behind the company Celera that sought to sequence the human genome before the public Human Genome Project, with the aim of patenting as much of it as possible. Fortunately, the Human Genome Project managed to stitch together the thousands of DNA fragments it had analysed – not least thanks to some serious hardware running GNU/Linux – and to put its own human genome in the public domain, thus thwarting Celera's plans to make it proprietary.

A nice twist to this story is that it turned out that Celera's DNA sequence was not, as originally claimed, another composite, but came almost entirely from one person: Craig Venter himself. So his latest project is in many ways simply the completion of this earlier attempt to become the first human with a fully-sequenced genome. The difference now, though, it that it will be in the public databases, and hence accessible by anyone.

This will have profound consequences. Aside from placing his DNA fingerprint out in the open – which will certainly be handy for any police forces that wish to investigate Venter – it means that anyone can analyse his DNA for anything. At the very least, scientists will be able to carry out tests for genetic pre-dispositions to all kinds of common and not-so-common diseases.

So it might happen that a laboratory somewhere discovers that Venter is carrying a genetic variant that has potentially serious health implications. Most of us will be able to choose whether to take such tests and hence whether to know the results, which is just as well. In the case of incurable diseases, for example, the knowledge that there is a high probability – perhaps even certainty – that you will succumb at some point in the future is not very useful unless there is a cure or at least a treatment available. Venter no longer has that choice. Whether he wants it or not, others can carry out the test and announce the result; since Venter is a scientific celebrity and a public figure, he is bound to get to hear about it one way or another.

So while his decision to sequence his genome might be seen as the ultimate act of egotism, by choosing to publish the result he will in fact be providing science with a wonderfully rich resource - the complete code of his life - and at some considerable risk, if only psychological, to himself.

Googling the Genome

I came across this story about Google winning an award as part of the "Captain Hook Awards for Biopiracy" taking part in the suitably piratical-sounding Curitiba, Brazil. The story links to the awards Web site - rather fetching in black, white and red - where there is a full list of the lucky 2006 winners.

I was particularly struck by one category: Most Shameful Act of Biopiracy. This must have been hard to award, given the large field to choose from, but the judges found a worthy winner in the shape of the US Government for the following reason:

For imposing plant intellectual property laws on war-torn Iraq in June 2004. When US occupying forces “transferred sovereignty” to Iraq, they imposed Order no. 84, which makes it illegal for Iraqi farmers to re-use seeds harvested from new varieties registered under the law. Iraq’s new patent law opens the door to the multinational seed trade, and threatens food sovereignty.

Google's citation for Biggest Threat to Genetic Privacy read as follows:

For teaming up with J. Craig Venter to create a searchable online database of all the genes on the planet so that individuals and pharmaceutical companies alike can ‘google’ our genes – one day bringing the tools of biopiracy online.

I think it unlikely that Google and Venter are up to anything dastardly here: from studying the background information - and from my earlier reading on Venter when I was writing Digital Code of Life - I think it is much more likely that they want to create the ultimate gene reference, but on a purely general, not personal basis.

Certainly, there will be privacy issues - you won't really want to be uploading your genome to Google's servers - but that can easily be addressed with technology. For example, Google's data could be downloaded to your PC in encrypted form, decrypted by Google's client application running on your computer, and compared with your genome; the results could then be output locally, but not passed back to Google.

It is particularly painful for me to disagree with the Coalition Against Biopiracy, the organisation behind the awards, since their hearts are clearly in the right place - they even kindly cite my own 2004 Googling the Genome article in their background information to the Google award.