Welcome to the Era of Personal Genomics

I've been wittering on about personal genomics for some time: well, it's here, people. If you don't believe, me, take a look at this site (note, it's one of those old-fashioned FTP thingies, but Firefox should cope just fine).

Not much to see, you say? Just a couple of boring old directories - one called "Venter", the other "Watson". And inside those directories, lots of pretty massive files - some 35 Mbytes, some double that. And inside those files? Oh, just some boring letters; you know the kind of thing - AAGTGGTACCATTGACGCACAGGACACAGTG etc.

Nothing much: just the essence of the first two people to have their entire genomes (or nearly) sequenced - and all made freely available.... (Via Discovering Biology in a Digital World.)

DNA = Do Not Ask

This will end in tears:

Although the ability to conduct a home DNA test and get the results with relative ease are tempting, the thought of sitting across the kitchen table with a distant cousin-husband may be little too weird to down with the morning coffee.

Maybe Genomics is Getting a Little Too Personal

So Jim Watson's genome will soon be made public. But not all of it:

the only deliberate omission from Watson's sequence is that of a gene linked to Alzheimer's disease, which Watson, who is now 79, asked not to know about because it is incurable and claimed one of his grandmothers.

The trouble is, the better our bioinformatics gets, the more genes we will be able to analyse usefully, and the better our ability to make statistical predictions from them. Which means that more and more people will be snipping bits out of their public genomes in this way. And which also means that many of us will never put any of our genome online.

The Personal Genome Part 265

Here's Nick Wade reviewing candidate technologies for the sub-$1000 genome. It's coming, people.

Personal Genomics...but Not Yet

A new X-prize, this time for exploring inner rather than outer space, has been announced. To win the prize money, all you have to do is sequence the DNA of a 100 or more people in a few weeks. That may sound a little vague, but it is many orders of magnitude faster than we can do it now (and remember, the first human genome took about 15 years and three billion dollars).

Why bother? Well, it will open up the world of personal genomics: where the particular details of your genome - not the human genome in general - will be used to aid diagnosis and help doctors make decisions about treatment.

The X-prize announcement is really tantamount to recognising that all those breathless predictions of imminent personal genomes, made by some at the time of the Human Genome Project, were rather optimistic.

I have to say that I, for one, am not too sad. Much as I'd like to Google my genome, being able to do so will also raise considerable ethical dilemmas, as I discussed in my book Digital Code of Life.

As St. Augustine nearly said: "Give me genotypability - but not yet...."