15 July 2012
15 August 2007
Welcome to the Era of Personal Genomics
I've been wittering on about personal genomics for some time: well, it's here, people. If you don't believe, me, take a look at this site (note, it's one of those old-fashioned FTP thingies, but Firefox should cope just fine).
Not much to see, you say? Just a couple of boring old directories - one called "Venter", the other "Watson". And inside those directories, lots of pretty massive files - some 35 Mbytes, some double that. And inside those files? Oh, just some boring letters; you know the kind of thing - AAGTGGTACCATTGACGCACAGGACACAGTG etc.
Nothing much: just the essence of the first two people to have their entire genomes (or nearly) sequenced - and all made freely available.... (Via Discovering Biology in a Digital World.)
Posted by
Glyn Moody
at
2:22 pm
0
comments
Labels: craig venter, ftp, jim watson, personal genomics, sequencing
01 June 2007
Maybe Genomics is Getting a Little Too Personal
So Jim Watson's genome will soon be made public. But not all of it:the only deliberate omission from Watson's sequence is that of a gene linked to Alzheimer's disease, which Watson, who is now 79, asked not to know about because it is incurable and claimed one of his grandmothers.
The trouble is, the better our bioinformatics gets, the more genes we will be able to analyse usefully, and the better our ability to make statistical predictions from them. Which means that more and more people will be snipping bits out of their public genomes in this way. And which also means that many of us will never put any of our genome online.
Posted by
Glyn Moody
at
3:06 pm
0
comments
Labels: bioinformatics, genes, genome, jim watson, personal genomics, public data