Hi-De-Hi HiPiHi
One of the first detailed looks at what promises to be an important entrant in the virtual world space.
open source, open genomics, open creation
One of the first detailed looks at what promises to be an important entrant in the virtual world space.
Posted by
Glyn Moody
at
9:54 am
Labels: china, hipihi, second life, virtual worlds, Zhao Gang
I've not written about the Rambus case before, because it seemed frankly rather dull. But I was wrong: there is an important principle at its heart:European Union regulators have charged Rambus Inc. with antitrust abuse, alleging the memory chip designer demanded ''unreasonable'' royalties for its patents that were fraudulently set as industry standards.
The EU's preliminary charges, announced Thursday, come weeks after the U.S. Federal Trade Commission ruled the company deceived a standards-setting committee by failing to disclose that its patented technology would be needed to comply with the standard.
As a result, every manufacturer that wanted to make synchronous dynamic access memory chips had to negotiate a license with Rambus.
Both EU and U.S. antitrust officials allege that this allowed Rambus gain an illegal monopoly in the 1990s for DRAM chips used in personal computers, servers, printers, personal digital assistants and other electronics.
Clearly these kinds of patent ambushes are potentially a general problem, and indicate why real standards must only allow completely patent-free technologies. If a company wants its patented technology to become a standard, it must give its patents.
Gone in a snap - it seemed to be slowing things down. Anyone care about its snip?
Posted by
Glyn Moody
at
9:32 am
Labels: snap preview anywhere, snipped
More tiny steps by Microsoft towards openness:In Linux circles, Microsoft's anti-Linux site, Get the Facts, was better known as Get the FUD, and was seen as more of a joke than a convincing argument in favor of Microsoft products over Linux. Microsoft may have come to agree that the site was not serving any useful purpose, as the company closed it down on Aug. 23.
Posted by
Glyn Moody
at
9:28 am
Labels: fud, get the facts, Microsoft, openness, straws in the wind
Upholding licences is crucial to the success of free software, so potentially, this looks really bad news:Open-source software and the licenses that govern it suffered a serious setback in a San Francisco District Court earlier this month, following a preliminary decision that could effectively deprive open source licensors from being able to get a court injunction to stop the violation of the terms of their license going forward.
Although the judge's analysis is superficially worrying for the way he interprets the licence, there is an important fact in this particular situation, which has already involved tussles over software patents:At issue was model train software code that Jacobsen and some other open source developers wrote, called the Java Model Railroad Interface, or JMRI, which is licensed under the Open Source Initiative approved Artistic License.
Now the Artistic Licence, originally drawn up by Larry Wall for Perl - and whose name was chosen purely for the pun it allowed - is a notoriously loose licence. IANAL, but it seems to me that the problem the judge has with granting an injunction against the model train software company is that the Artistic Licence simply gives, well, too much licence.
I may be wrong, but I think the far more demanding GNU GPL would avoid this problem - another good reason for choosing a more rigorous licence. We shall see whether I am right....
Posted by
Glyn Moody
at
8:44 am
Labels: artisitic licence, gnu gpl, injunction, Java Model Railroad Interface, jmri, larry wall, perl
Those open and sharing memes are spreading like wildfire in the most surprising places - like law, for example. In the US, there are two new important projects to place legal decisions online, freely available to all. There's Carl Malamud's database of legal opionions, and Tim Wu's AltLaw project.
But the thing that interested me most was a comment to the announcement of latter, which pointed out that that these US-based efforts are actually trailing equivalent moves elsewhere. The excellent site World Legal Information Institute has links to over a dozen of them. Shame on me for not discovering them sooner.
Posted by
Glyn Moody
at
8:22 am
Labels: altlaw, carl malamud, openness, sharing, tim wu, wlii, world legal information institute
Nothing new here for readers of this blog, but good to see others moving in the same direction:
I believe we should consider anything we publish on the web as an advertisement: promotion material, and only that. We can use this to sell the following:
* pretty or convenient copies (maybe we will see the reappearance of the artful music album!)
* signed copies
* limited edition high quality copies (things one can proudly display on a wall at home)
* time: live performances!
Posted by
Glyn Moody
at
8:14 am
Labels: free content, limited editions, live performances, signed copies
One of the great but rather submerged stories in the open source world is stack integration. With the exception of the LAMP stack, free software solutions have been rather fragmented, with little inter-project coordination. One important development in this space is the creation of the Open Solutions Alliance, whose main task is ensuring better cooperation between disparate products.
I wrote about this recently, and I notice that the OSA blog is quite active at the moment. It's a good place to find out what exactly is happening in this important but neglected area.
Posted by
Glyn Moody
at
8:02 am
Labels: application stack, blogs, LAMP, open solutions alliance, osa
For anyone that cares - well, there might be someone - Radio Opendotdotdot is falling silent for a few days. Back soon.
Posted by
Glyn Moody
at
12:30 pm
Labels: opendotdotdot, radio
The ODF vs. OOXML battle is really hotting up - a sure sign that this is important. One of the key issues is whether OOXML can ever be fully implemented by anyone else other than Microsoft: if it can't, then it can hardly be called a true open standard. Here's some analysis that suggest is can't. Not that will stop it becoming one....
Posted by
Glyn Moody
at
8:25 am
Labels: new zealand, odf, ooxml, open standards
The open source anti-virus software project ClamAV is one of my favourite pieces of free code. I've used it for years now, and recommended it to dozens of people. But I've always been a bit worried about its business model: could it continue to grow?
Well, now it looks like it can, since Sourcefire, creator of SNORT, has acquired the project:
With nearly 1 million unique IP addresses downloading ClamAV malware updates daily across more than 120 mirrors in 38 countries, ClamAV is one of the most broadly adopted open source security projects worldwide. ClamAV has also been recognized as comparable in quality and coverage to leading commercial anti-virus solutions. Most recently, at LinuxWorld this year, ClamAV was one of only three anti-virus technologies to provide a 100% detection rate in their live 'Fight Club' test featuring live submissions from the show audience.
Under terms of the transaction, Sourcefire has acquired the ClamAV project and related trademarks, as well as the copyrights held by the five principal members of the ClamAV team including project founder Tomasz Kojm. Sourcefire will also assume control of the open source ClamAV project including the ClamAV.org domain, web site and web site content and the ClamAV Sourceforge project page. In addition, the ClamAV team will remain dedicated to the project as Sourcefire employees, continuing their management of the project on a day-to-day basis.
As the above points out, ClamAV was one of only three anti-virus technologies to provide a 100% detection rate, and this only reinforces my confidence is using it day-in, day-out. If you don't know it, do take a look. (Via Matthew Aslett.)
Posted by
Glyn Moody
at
1:47 pm
Labels: antivirus, clamav, snort, sourcefire
Oh look, here's unnecessary, Draconian intellectual monopoly regulation that has major negative consequences:
An unexpected implication in the legislating procedure of the proposed EU Directive on criminal measures aimed at ensuring the enforcement of intellectual property rights (IPRED2) puts legitimate businesses under clear threat of criminal sanctions.
Now, why am I not surprised by this?
Posted by
Glyn Moody
at
6:55 pm
Labels: eu, intellectual monopolies, ipred2, parallel imports
With The New York Times and The Wall Street Journal said to be looking at removing the “pay wall” around their online content, and others – including CNN, Google and AOL – having already done so, one question springs to mind: Are we seeing the death of paid content online, and the return of free as a business model?
Yup - at least, free as in beer: now we need to work on the free as in freedom part.
Posted by
Glyn Moody
at
4:51 pm
Labels: aol, cnn, free, google, New York Times, pay wall, wall street journal
...is coming. And you thought the privacy issues of using Google were bad now. (Via John Battelle.)
Posted by
Glyn Moody
at
1:17 pm
Labels: google health, john battelle, privacy
This piece from The Courant is like the coelacanth: not very pretty, but fascinating for its atavistic traits:Unlike copyright-protected software, such as Microsoft's Windows, open source software is available either as a free public-domain offering or under a nominal licensing fee.
Well, no. To be strictly open source, software must have an OSI-approved licence. Such licences generally (always?) depend on copyright law for their enforcement. So, by definition, open source software uses copyright as much as Microsoft's Windows, just for different ends.
This was a common confusion when free software started appearing in the mainstream, but it's quite surprising to see it popping up nowadays.
Posted by
Glyn Moody
at
11:57 am
Labels: coelacanth, copyright, Microsoft, public domain, the courant, Windows
Talking of the price we pay for idiotically closed geographical data:The United States has benefitted in many ways from having public data sets that are freely used by scholars, commercial firms, consultants, and the public. An example of this is the TIGER system (Topologically Integrated Geographic Encoding and Referencing system http://www.census.gov/geo/www/tiger/) Many countries do not, and one British geospatial expert estimated that the closed nature of their system has cost them one billion pounds in lost business.
(Via Open Access News.)
Posted by
Glyn Moody
at
8:42 am
Labels: european union, geospatial data, inspire, ordnance survey
This really makes my blood boil.After a year of negotiations, academic geographers have conceded defeat in their attempt to find a way to make a pioneering 3D representation of the capital, Virtual London, available to all comers via the Google Earth online map.
Followers of Technology Guardian's Free Our Data campaign will have guessed the reason: Virtual London is partly derived from proprietary data owned by the government through its state-owned mapping agency, Ordnance Survey (OS). What makes the situation bizarre is that Virtual London's development was funded by another arm of the government, the office of the mayor of London.
In other words, I helped pay for this information, twice - as taxpayer, and as London ratepayer - and yet I am not allowed to access it.
The Ordnance Survey's excuse is pathetic:OS said granting Google special terms for Virtual London would be unfair on other licensees. "We provide an open, fair and transparent set of terms for providers seeking to operate in the same commercial space as each other. We cannot therefore license Google in a different way to other providers. We are completely supportive of anyone putting our data on the web as long as they have a licence to do so." Google would not comment.
Commercial space - and what about the public space, you know those tiresome little people that pay for your salary?
Thanks for nothing.
Posted by
Glyn Moody
at
8:27 am
Labels: free our data, google earth, guardian, ordnance survey, virtual london
About 18 months ago, I wrote a post called "Open Source's Best-Kept Secret" about Eclipse, how wonderful it was, and yet how few knew about it. Now what do I find?Eclipse may be the most important open-source "project" that people outside the industry, and even some within it, have never heard of.
Yup, Matt and I agree again. His piece is an excellent interview with the head of Eclipse, Mike Milinkovich. I also interviewed him recently, for my feature about the open source ecosystem in Redmond Magazine. Matt's ranges more widely, and is probably the best intro to what Eclipse is up to, how it functions, and why it is so important.
Indeed, I wonder whether it will actually prove to be the most important open source project of all in the long term. As Matt points out:In late June, Eclipse made available the largest-ever simultaneous release of open-source software, called Europa: 17 million lines of code, representing the contributions of 310 open-source developers in 19 countries. Twenty-one new tools were included in the "Europa" release, all free to download.
Think about that. The Linux kernel has around 6 million lines of code.... The Java Development Kit that Sun open sourced has 6.5 million.... Sun's StarOffice release in 2000 (which was believed to be the largest open-source release to that point) had 9 million.... Firefox has 2.5 million.
Yeah, think about it....
Posted by
Glyn Moody
at
6:54 am
Labels: eclipse, eclipse java, europa, Matt Asay, mike milinkovich, staroffice firefox
...and I did eat:But now an international scientific counterculture is emerging. Often referred to as “open science,” this growing movement proposes that we err on the side of collaboration and sharing. That’s especially true when it comes to creating and using the basic scientific tools needed both for downstream innovation and for solving broader human problems.
Open science proposes changing the culture without destroying the creative tension between the two ends of the science-for-innovation rope. And it predicts that the payoff – to human knowledge and to the economies of knowledge-intensive countries like Canada – will be much greater than any loss, by leveraging knowledge to everyone’s benefit.
"Sharing the fruits of science", it's called. Nothing new, but interesting for the outsider's viewpoint. (Via Open Access News.)
Posted by
Glyn Moody
at
4:56 pm
Labels: intellectual monopolies, open notebook science, open science
I've been wittering on about personal genomics for some time: well, it's here, people. If you don't believe, me, take a look at this site (note, it's one of those old-fashioned FTP thingies, but Firefox should cope just fine).
Not much to see, you say? Just a couple of boring old directories - one called "Venter", the other "Watson". And inside those directories, lots of pretty massive files - some 35 Mbytes, some double that. And inside those files? Oh, just some boring letters; you know the kind of thing - AAGTGGTACCATTGACGCACAGGACACAGTG etc.
Nothing much: just the essence of the first two people to have their entire genomes (or nearly) sequenced - and all made freely available.... (Via Discovering Biology in a Digital World.)
Posted by
Glyn Moody
at
2:22 pm
Labels: craig venter, ftp, jim watson, personal genomics, sequencing
Once again, Matt gets it, and Tim doesn't: "I will predict that virtually every open source company (including Red Hat) will eventually be acquired by a big proprietary software company."
Thus spake Tim O'Reilly in the comments to one of his other posts. Tim believes that open source, at least as defined by open-source licensing, has a short shelf-life that will be consumed by Web 2.0 (i.e., web companies hijacking open-source software to deliver proprietary web services) or by traditional proprietary software vendors.
In other words, why don't I just give up, sell out, and go home? I guess I would if I thought that Tim were right. He's not, not in this instance.
There's something more fundamental going on here than "Proprietary software meets open source. Proprietary software decides to commandeer open source. Open source proves to be a nice lapdog to proprietary software." I actually believe that open source, not proprietary software, is the natural state of the industry, and that Tim's proprietary world is anomalous.
I particularly liked this distinction between the service aspects of software, and the attempts to view it as an instantiation of various intellectual monopolies:
Suddenly, the license matters more, not less, because it is the license that ensures the conversation focuses on the right topic - service - rather than on inane jabberings that only vendors care about. You know, like intellectual property.
And there's another crucial reason why proprietary software companies can't just open their chequebooks and acquire those pesky open source upstarts. Unlike companies who seem to think that they are co-extensive with the intellectual monopolies they foist on customers, open source outfits know they are defined by the high-quality people - both employees and those out in the community - that code for the customers.
For example, one reason people take out subscriptions to Red Hat's offerings is that they get to stand in line for the use of Alan Cox's brain. Imagine, now, that proprietary company X "buys" Red Hat: well, what exactly does it buy? Certainly not Alan Cox's brain, which will leave with him (one hopes) when he moves immediately to another open source company (or just hacks away in Wales for pleasure). Sure, the purchaser will have all kinds of impressive legal documents spelling out what it "owns" - but precious little to offer customers anymore, who are likely to follow wherever Alan Cox and his ilk go.
Posted by
Glyn Moody
at
1:35 pm
Labels: alan cox, intellectual monopolies, Matt Asay, red hat, services, tim o'reilly, web 2.0
When I first heard about Fedora Commons I naively assumed it had something to do with the Linux distro Fedora, but I was wrong:Fedora Commons is a non-profit organization providing sustainable technologies to create, manage, publish, share and preserve digital content as a basis for intellectual, organizational, scientific and cultural heritage by bringing two communities together.
Communities of practice that include scholars, artists, educators, Web innovators, publishers, scientists, librarians, archivists, publishers, records managers, museum curators or anyone who presents, accesses, or preserves digital content.
Software developers who work on the cutting edge of open source Web and enterprise content technologies to ensure that collaboratively created knowledge is available now and in the future.
Fedora Commons is the home of the unique Fedora open source software, a robust integrated repository-centered platform that enables the storage, access and management of virtually any kind of digital content.
So not only is Fedora an organisation - recently funded to the tune of $4.9 million by the Gordon and Betty Moore Foundation - aiming to create a commons of "intellectual, organizational, scientific and cultural heritage", but it is also a piece of code:Institutions and organizations face increasing demands to deliver rich digital content. A scan of the web reveals complex multi-media content that combines text, images, audio, and video. Much of this content is produced dynamically through the use of servlet technology and distributed web services.
Delivery of rich content is possible through a variety of technologies. But, delivery is only one aspect of a suite of content management tasks. Content needs to be created, ingested, and stored. It needs to be aggregated and organized in collections. It must be described with metadata. It must be available for reuse and refactoring. And, finally, it must be preserved.
Without some form of standardization, the costs of such management tasks become prohibitive. Content managers find themselves jury-rigging tasks onto each new form of digital content. In the end, they are faced with a maze of specialized tools, repositories, formats, and services that must be upgraded and integrated over time.
Content managers need a flexible content repository system that allows them to uniformly store, manage, and deliver all their existing content and that will accommodate new forms that will inevitably arise in the future.
Fedora is an open source digital repository system that meets these challenges.
In fact, Fedora is nothing less than "Flexible Extensible Digital Object Repository Architecture". So the name is logical - pity it's so confusing in the context of open source.
Posted by
Glyn Moody
at
9:24 am
Labels: commons, content repository, Fedora, fedora commons
Get your umbrellas out for the Linux Weather Forecast:The need for a Linux Weather Forecast arises out of Linux’s unique development model. With proprietary software, product managers define a “roadmap” they deliver to engineers to implement, based on their assessments of what users want, generally gleaned from interactions with a few customers. While these roadmaps are publicly available, they are frequently not what actually gets technically implemented and are often delivered far later than the optimistic timeframes promised by proprietary companies.
Conversely, in Linux and open source software, users contribute directly to the software, setting the direction with their contributions. These changes can quickly get added to the mainline kernel and other critical packages, depending on quality and usefulness. This quick feedback and development cycle results in fast software iterations and rapid feature innovation. A new kernel version is generally released every three months, new desktop distributions every six months, and new enterprise distributions every 18 months.
While the forecast is not a roadmap or centralized planning tool, the Linux Weather Forecast gives users, ISVs, partners and developers a chance to track major developments in Linux and adjust their business accordingly, without having to comb through mailing lists of the thousands of developers currently contributing to Linux. Through the Linux Weather Forecast, users and ecosystem members can track the amazing innovation occurring in the Linux community. This pace of software innovation is unmatched in the history of operating systems. The Linux Weather Forecast will help disseminate the right information to the ever growing audience of Linux developers and users in the server, desktop and mobile areas of computing, and will complement existing information available from distributions in those areas.
Good to see Jonathan Corbet, editor of LWN.net, for whom I write occasionally, spreading some of his deep kernelly knowledge in this way.
Posted by
Glyn Moody
at
6:30 am
Labels: jonathan corbet, linux foundation, linux weather forecast, lwn
Facebook creaks open a little more - and RSS is the lubricant. (Via TechCrunch.)
To the extent possible under law,
glyn moody
has waived all copyright and related or neighbouring rights to
this work.
This work is published from:
United Kingdom.